#/mnt/gattaca/jhughes/alignace/all_motifs_3/GAL.ace #0 YBR018C 500 bp YBR018C gal7 1-1101 galactose-1-phosphate uridyl transferase #1 YBR019C_YBR020W 668 bp YBR019C gal10 1-2100 UDP-glucose 4-epimerase YBR020W gal1 1-1587 galactokinase #2 YDR009W 500 bp YDR009W GAL3 1-1563 galactokinase #3 YER027C 459 bp YER027C GAL83 1-1254 #4 YLR081W 500 bp YLR081W gal2 1-1725 galactose permease #5 YML051W 283 bp YML051W gal80 1-1308 regulatory protein #6 YOL051W 500 bp YOL051W gal11 1-3246 Component of the RNA polymerase II holoenzyme complex, positive and negative transcriptional regulator of genes involved in mating-type specialization #7 YPL248C 268 bp YPL248C gal4 1-2646 zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type #Motif 1 CGCTCAACAGTGCTCCGAAG 0 218 0 CGGTCAACAGTTGTCCGAGC 0 305 0 CGGCGGCTTCTAATCCGTAC 1 212 0 CGGAGGGCTGTCGCCCGCTC 1 231 0 CGGAAGACTCTCCTCCGTGC 1 252 1 CGTCCTCGTCTTCACCGGTC 1 271 1 CGCGCCGCACTGCTCCGAAC 1 316 1 CGAGATCCGTTTAACCGGAC 2 170 1 CGGTCCACTGTGTGCCGAAC 2 212 1 CGGCGGTCTTTCGTCCGTGC 4 84 1 CGGCGCAGATATCTCCGCAC 4 100 0 CGGGGCGGATCACTCCGAAC 4 167 1 CGGCGCACTCTCGCCCGAAC 5 111 1 CGGCCCCGGTTGCGTCGATC 6 220 1 *** * * * *** *